Home /  Academics /  School of Engineering /  Research /  Cloud Computing Cluster /  Projects / 

Zinc Finger Recognition Code

Zinc Finger Recognition Code

We produced the entire recognition code of a single finger of one of the most ubiquitous and abundant human zinc finger and several of its modifications. The result of our in vitro assay (EMSA) shows the degenerated recognition code of the second finger of Sp1. Results are ready for publication.
Result of EMSA for 2nd finger of Sp1:

(a) Bandshifts (Sp1 binding domain/P32 oligonucleotide complex)

fig-a

Recombinant Sp1 protein was purified by FPLC Mono S chromatography. The DNA binding activity of Sp1 protein has been assessed by incubating the 64 P32-labeled double-stranded oligonucleotides (n = 3) 5’GTCGGATCCTGTCTGAGGTGAGTTGGG NNN GGGCTTGTCTTCCGACGTCGAATTCGCG3’ and performing electrophoresis mobility shift assays (EMSA).

(b) Phosphor Imager Readings of above Bandshifts

fig-b

Recognition code of Sp1 using electrophoresis mobility shift assay (EMSA) of 64 binding GGG NNN GGG triplets of 2. Finger of Sp1 (A, C, G, T-series).

(c) Analysis of Phosphor Imager Readings for the 2nd finger of Sp1

fig-c

Computational result showing complete recognition code of the 2nd finger Sp1 binding sites.

Above electrophoretic mobility shift assay (EMSA) data contradict the popular believe that the 2nd finger of Sp1 only binds GCG e.g. (Uno, Matsushita, Nagaoka, & Sugiura, 2001). The data leads to the discovery of the complete recognition code of a single finger. Figure 3 shows the degenerated recognition code of all 64 possible triplets one finger can bind to. Surprisingly we see one finger binds most 64 DNA triplets. The recognition code gives strong support to the notion that cytotoxicity can be associated to binding at unintended regions on the genome.

Especially problematic is the finding that the finger binds many sequences with decreasing (degenerated) specificity and affinity. This degeneration of the recognition code also includes AT-rich triplets as potential top binding sites that can cause cytotoxicity., which complicate matters to predict and handle clinical viable zinc fingers. For clinical development it is necessary to produce the complete degenerated recognition code for each of the fingers and entire binding domain.